rs823247 chr2:2846768 C>T
- Sequence
gttttcaaagctctcctcctcctt[C/T]tcctgttatttaaggtcataccac
- ASB in cell types
- NCI-H2171 (small cell lung carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NCI-H2171 (small cell lung carcinoma) | 0.36 | 1.90 | 1.80 | |||
| foreskin keratinocyte | 1.85 | -0.14 | 3.00 |
Items per page:
1 – 2 of 2