rs851058 chr17:43760351 G>A
- Sequence
tgttgtgagaagctggccctccgc[G/A]ccacctccccttgtctatgaccct
- ASB in cell types
- foreskin keratinocyte T47D (invasive ductal carcinoma) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.15 | n/a | 1.94 | |||
| T47D (invasive ductal carcinoma) | 1.00 | 0.88 | 1.00 | |||
| bipolar neuron | -0.13 | 0.97 | 1.25 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood