rs861884 chr16:56945585 T>A
- Sequence
catccccactggggcaagcaggac[T/A]cttagcaattaaggcctaagacgg
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ICN12 (primary pre-B acute lymphomablastic leukemia) | 2.17 | -2.06 | 1.33 |
Items per page:
1 – 1 of 1