rs869521 chr1:208604550 A>G
- Sequence
gtgaaatgagtcagatgaaaatta[A/G]tcactttgtgctctctgagaaaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
- ASB for transcription factors
- STAG1_HUMAN JUNB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.75 | 1.81 | 1.00 | n/a | n/a | |||
| JUNB_HUMAN | -2.24 | 2.67 | 1.00 | 5.44 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, aortic valve calcium, homa-b, hypertension (early onset hypertension), stabilized warfarin dose, tardive dyskinesia