rs875571 chr3:186208912 T>C
- Sequence
aaagacctggaatcttctctctta[T/C]cagttttcagcaatgaagttttgg
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | 1.97 | -1.33 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.04 | -1.84 | 1.00 |
Items per page:
1 – 2 of 2