rs877256 chr10:93459077 C>T
- Sequence
aagcttcagcgtgacgctcctcgt[C/T]ggcttgtgcccagacctatcctgg
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma) HKC8 (kidney proximal tubule cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | -0.26 | 1.60 | 2.00 | |||
| HKC8 (kidney proximal tubule cell line) | 0.11 | 1.20 | 1.00 |
Items per page:
1 – 2 of 2