rs881152 chr5:172771552 G>A
- Sequence
cgggatgcgagcggccgggagaac[G/A]ggcgacgtgccacctgccttggcc
- ASB in cell types
- A549 (lung carcinoma) MOLT-4 (Adult T acute lymphoblastic leukemia) SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.98 | 0.19 | 2.09 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.28 | -0.32 | 1.00 | |||
| SUM159PT (Triple negative breast cancer) | 1.15 | 0.01 | 1.00 |
Items per page:
1 – 3 of 3