rs881996 chr21:14978433 G>T
- Sequence
tcaacccacctaatgccccaaaag[G/T]tatctatgttcacaactttcttct
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | -1.00 | 1.43 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1