rs886847 chr12:1605709 T>C
- Sequence
cgctctcaaggggaggctcttgcg[T/C]gtcaatttctgccaagtgccattt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) Peyer's patch GM18486 (Lymphoblastoid Cell Lines) CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.65 | 0.93 | 1.03 | |||
| Peyer's patch | -1.90 | 2.29 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.39 | 1.61 | 1.00 | |||
| CD14+ monocytes | -0.85 | 1.37 | 2.00 |
Items per page:
1 – 4 of 4