rs892019 chr19:13163617 G>C
- Sequence
gtgtccagatgagttcagagcccc[G/C]acgtttgtccaggaaagcccacct
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney) HCT-116 (colon carcinoma)
- ASB for transcription factors
- GLIS1_HUMAN MBD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | 2.52 | -1.55 | 2.00 | n/a | n/a | |||
| MBD4_HUMAN | 1.33 | -0.47 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, body mass index (bmi), college completion, height, triglycerides change with statins, years of education
GTEx eQTL Adrenal_Gland, Artery_Aorta, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg