rs902594 chr5:125696771 A>G
- Sequence
taggatttgtttttaggaataata[A/G]atattatctcaaatctattatctt
- ASB in cell types
- A549 (lung carcinoma) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- GATA3_HUMAN ONEC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 0.30 | 1.88 | 1.40 | n/a | No Hit | |||
| ONEC2_HUMAN | 0.67 | 3.39 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd