rs902923 chr9:91571317 C>T
- Sequence
tcacaagttctgcaaggcagaaca[C/T]tctcttcccattagcctcaatctc
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | -1.59 | 0.93 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP emergence of suicidal ideation during treatment with antidepressants, emergence of suicidal ideation during treatment with antidepressants (broad definition - no increase in suicide ideation), emergence of suicidal ideation during treatment with antidepressants (narrow definition - emergence from suicidal ideation absent at baseline), height, ldl cholesterol, major depressive disorder, microalbuminuria, primary rhegmatogenous retinal detachment, total cholesterol