rs904966 chr1:19445683 G>C
- Sequence
aaatggccagacagaaagtgaatg[G/C]tgagctggggcaggagtgggcatg
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | n/a | 2.19 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood