rs909030 chr18:77650864 T>C
- Sequence
taaccgccgtactttccttcccaa[T/C]gtttgtgtggagagcacacggttc
- ASB in cell types
- GSC23 (Glioblastoma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GSC23 (Glioblastoma) | n/a | 3.36 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.83 | 0.83 | 1.00 |
Items per page:
1 – 2 of 2