rs910152 chr20:62836546 G>C
- Sequence
gatgatcagcggtaagtcagccac[G/C]tgcaccggctgcagcggggcccat
- ASB in cell types
- HepG2 (hepatoblastoma) primary human epidermal keratinocytes
- ASB for transcription factors
- AGO2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AGO2_HUMAN | -1.60 | 2.24 | 1.17 | n/a | n/a |
Items per page:
1 – 1 of 1