rs912914 chr20:44683756 T>C
- Sequence
agaaagcaaacctctggatccatc[T/C]ggaagcaggtagcaggtgttgccc
- ASB in cell types
- stomach HepG2 (hepatoblastoma) GM18526 (B – cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | n/a | 1.96 | 3.00 | 4.42 | Concordant | |||
| SRF_HUMAN | -2.13 | 2.27 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, infant head circumference
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid