rs916298 chr6:36769802 A>G
- Sequence
ccttcatcgaggccatctgtggag[A/G]tgcctgatagggcgcctggccctc
- ASB for transcription factors
- GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | 1.97 | -0.71 | 1.00 | 0.55 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
