rs919655 chr1:213984629 G>A
- Sequence
cacaggagatgagagtgagaggcc[G/A]tcagtcagttttgcctctagaaag
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PKNX1_HUMAN MAZ_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 2.51 | -2.29 | 1.00 | -5.20 | Concordant | |||
| MAZ_HUMAN | -5.04 | 2.96 | 2.00 | -0.20 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Heart_Atrial_Appendage, Liver, Pancreas, Pituitary, Spleen, Testis, Thyroid