rs920684 chr4:4290696 C>T
- Sequence
cccgctggaagccagcccggcccg[C/T]ctccgctacgcgctgcccatctct
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.52 | 0.12 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Whole_Blood