rs923993 chr8:15378478 C>G
- Sequence
attgccatctgctgggaactttgg[C/G]cactgcacttatgtacaggaccac
- ASB in cell types
- gastroesophageal sphincter CD34+ stem cells-derived erythroblasts prostate gland esophagus squamous epithelium
- ASB for transcription factors
- CTCF_HUMAN PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.63 | 1.52 | 1.35 | n/a | No Hit | |||
| PKNX1_HUMAN | 1.76 | -1.53 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2