rs9270986 chr6:32606283 A>C
- Sequence
taagaaattactgggcataactag[A/C]aggtgccatgggatgtgcctggaa
- ASB in cell types
- primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -1.14 | 2.18 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), college completion, crohns disease, hdl cholesterol, height, hypertension, immune control of hiv-1 viremia, irritible bowel syndrome, lp-pla2 activity, lp-pla2 mass, lumiracoxib-related liver injury (measured by elevated liver enzymes), lupus anticoagulant, lymphocyte levels (cd4), lymphocyte levels (cd4:cd8), multiple sclerosis, parkinsons disease, rheumatoid arthritis, total cholesterol, total serum ige, triglycerides, type 1 diabetes, type 1 diabetes, rheumatoid arthritis, combined case analysis, gender differentiated, type 2 diabetes, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood