rs9277726 chr6:33123836 G>T
- Sequence
agcggcacgaaagaatttggaagc[G/T]gcagtgttacggtaaaaaaccgac
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) neutrophils from periferal blood K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -0.92 | 1.76 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 2.02 | -0.89 | 1.00 | |||
| neutrophils from periferal blood | -4.23 | 2.65 | 2.00 | |||
| K562 (myelogenous leukemia) | 1.04 | 0.32 | 2.88 | |||
| IPSC-derived bipolar neuron | 1.48 | -0.80 | 1.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood