rs9295140 chr6:157669711 A>G
- Sequence
gggggtattgtgtggacagaaagc[A/G]ttaggatgagtgagggctccagag
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.56 | 0.06 | 1.80 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, biploar disorder (bipolar schizoaffective disorder), birth weight, eye color, fasting blood glucose, hypertension, hypertension (early onset hypertension), irritible bowel syndrome, prop taste detection threshold, stabilized warfarin dose, systolic blood pressure (sbp), total cholesterol change with statins, triglycerides change with statins