rs930187 chr12:121214474 G>A
- Sequence
ctccctcaaaaaaagaccgaacac[G/A]caattctcatctatctaactctgt
- ASB in cell types
- CD14+ monocytes monocytes from periferal blood
- ASB for transcription factors
- STAT1_HUMAN TF65_HUMAN SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.78 | -1.15 | 3.00 | n/a | No Hit | |||
| TF65_HUMAN | 2.14 | 0.74 | 2.33 | n/a | No Hit | |||
| SRBP2_HUMAN | 1.66 | -1.05 | 3.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Thyroid, Whole_Blood