rs9304473 chr18:24837354 T>C
- Sequence
gatgactttggagctatgtagatc[T/C]gagtagtaattcacgagtttccta
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- NDF1_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NDF1_HUMAN | -0.41 | 2.20 | 1.00 | n/a | No Hit | |||
| REQU_HUMAN | 2.22 | 0.55 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hip bone mineral density (bmd), recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), salmonella-induced pyroptosis, schizophrenia