rs9311903 chr3:64635461 T>C
- Sequence
taaggaagactgcatctagggatg[T/C]aaaatggcacataacacagtcgtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.16 | 0.29 | 6.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, height, infant head circumference, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), systolic blood pressure (sbp)