rs931948 chr2:28377372 T>C
- Sequence
cctggacaccgcgacctgcgatca[T/C]tgaacgaggcacgcagcggtggtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.17 | 0.87 | 1.48 | |||
| breast tumor | -0.23 | 1.86 | 2.00 |
Items per page:
1 – 2 of 2