rs9329570 chr1:37883934 G>T
- Sequence
tctaaggctttgactttagacaaa[G/T]aggaagttgtagagataaatgaga
- ASB in cell types
- K562 (myelogenous leukemia) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ARI1B_HUMAN CTBP1_HUMAN SOX6_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 4.17 | -3.91 | 1.00 | n/a | n/a | |||
| CTBP1_HUMAN | 4.03 | -4.37 | 1.00 | n/a | n/a | |||
| SOX6_HUMAN | 3.19 | -2.99 | 1.00 | n/a | n/a | |||
| HDAC1_HUMAN | 2.00 | -1.56 | 1.00 | n/a | n/a | |||
| SPI1_HUMAN | 1.58 | -0.97 | 1.00 | -3.45 | Concordant |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Vagina, Whole_Blood