rs9333358 chr9:21078953 T>C
- Sequence
gaaaaaccgccctgaaccacttcc[T/C]ggttcaggaaaaataagctcttac
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 3.00 | -4.55 | 1.33 | -8.04 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting insulin, homa-ir, prop taste detection threshold
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid