rs9333631 chr7:155805301 C>T
- Sequence
ccgggagctctccgggccgcacac[C/T]cgcccctgccgcccccgctccacg
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.32 | 0.61 | 1.67 | -0.33 | Weak Concordant | |||
| STAG1_HUMAN | 1.51 | -0.07 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
