rs937171 chr15:49902552 C>G
- Sequence
cagaggtcacatggttccaagaat[C/G]atatcacacatttaacaatcagtt
- ASB in cell types
- HeLa (cervical adenocarcinoma) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | -0.09 | 1.32 | 1.50 | |||
| MCF7L-P(immortalized breast epithelial cell line) | n/a | 1.79 | 4.00 |
Items per page:
1 – 2 of 2