rs9376000 chr6:134003891 G>A
- Sequence
tgaaattgcataaaaaatgttggt[G/A]tttaagggcttactgccaagtaga
- ASB in cell types
- 22RV1 (prostate carcinoma) bone-marrow-derived mesenchymal stromal cells, adipocyte differentiation 4 hrs
- ASB for transcription factors
- ANDR_HUMAN MBD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 3.23 | n/a | 2.00 | n/a | No Hit | |||
| MBD4_HUMAN | -0.33 | 2.27 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2