rs9389871 chr6:141119156 T>G
- Sequence
agaaataatgaagtattatgggaa[T/G]cctggctccatgaaaaattgagca
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.19 | -0.71 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), height, homa-ir, infant head circumference, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Testis, Thyroid, Whole_Blood