rs94163 chr16:66478921 G>A
- Sequence
atgagcaaaggcccagaggcaggc[G/A]agcacgcgtgtgccacgctacaga
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) CD14+ monocytes CUTLL1 (T-cell lymphoblastic lymphoma 1) lymphoblastoid cells
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.85 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Whole_Blood