rs9424299 chr1:3800173 A>G
- Sequence
gctgctcatggccagctgacccca[A/G]ggctaggaccttagggaattccta
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- MYOD1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYOD1_HUMAN | 1.87 | -3.09 | 1.67 | n/a | No Hit | |||
| TF65_HUMAN | 0.08 | 1.92 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood