rs9446490 chr6:71855550 T>G
- Sequence
atagctgtacaatgttatgaagat[T/G]ctgtctgtttctacctttccctgt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02255 (Lymphoblastoid Cell Lines) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.60 | 0.06 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.91 | -0.63 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.40 | 1.78 | 2.33 |
Items per page:
1 – 3 of 3