rs944775 chr1:206495260 T>C
- Sequence
atcctgaccctgctttttaccaac[T/C]gcgtgaccctgggaggtgtgttca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NRF1_HUMAN PBX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | n/a | 2.46 | 3.00 | n/a | No Hit | |||
| PBX2_HUMAN | n/a | 3.00 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, infant head circumference, primary rhegmatogenous retinal detachment, tetrology of fallot
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Vagina, Whole_Blood