rs9452 chr16:12573932 G>T
- Sequence
ctgacaccgacttcttagagaagc[G/T]agtcttttttgaatggaggagcga
- ASB in cell types
- HepG2 (hepatoblastoma) thyroid gland GM12878 (female B-cells lymphoblastoid cell line) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.26 | 0.45 | 2.97 | |||
| thyroid gland | -0.79 | 2.21 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.25 | 0.90 | 1.43 | |||
| T47D (invasive ductal carcinoma) | 0.18 | 1.13 | 2.15 | |||
| adult erythroblasts | 2.37 | n/a | 3.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hip bone mineral density (bmd), longstanding arthritis, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood