rs9457722 chr6:157539573 A>G
- Sequence
ccgtttctatttaagaagagggaa[A/G]gaggaagacattgcaagtgggcca
- ASB in cell types
- MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia) macrophages form periferal blood monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.05 | -0.15 | 2.12 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | -0.15 | 0.82 | 1.50 | |||
| macrophages form periferal blood | 2.44 | -0.28 | 2.00 | |||
| monocyte-derived dendritic cells | 1.25 | -0.19 | 1.20 |
Items per page:
1 – 4 of 4