rs9469395 chr6:33280206 G>A
- Sequence
tccagcagagggaaacctgacccc[G/A]tccaggagaggggaatctcaccct
- ASB in cell types
- HUES64 (embryonic stem cells) TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | 2.42 | -1.21 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.35 | 1.98 | 1.00 |
Items per page:
1 – 2 of 2