rs94852 chr22:39316329 T>C
- Sequence
aaaatttcaacggtggacatgcac[T/C]ctcatccgtggtggccctcaccac
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.10 | 0.96 | 1.95 | |||
| foreskin keratinocyte | 2.55 | -0.03 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.26 | 0.88 | 1.10 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Heart_Left_Ventricle, Liver, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood