rs9506597 chr13:21034700 C>G
- Sequence
agctaccagtagcttgatttagtg[C/G]ttgtctgcttctgacacctggggc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -5.04 | 3.06 | 1.50 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | n/a | 2.49 | 3.00 |
Items per page:
1 – 2 of 2