rs9538833 chr13:60661740 A>G
- Sequence
gcaggcagccacagctgtggtgat[A/G]gctgcccctcctcccagggacttg
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 1.09 | -1.09 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1