rs9562070 chr13:114129737 G>A
- Sequence
ctgccttgtacgttcccaccggat[G/A]tagtagacaataattgcctggctt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- TF65_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | -0.26 | 2.66 | 2.50 | n/a | No Hit | |||
| FOXP1_HUMAN | 2.48 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Colon_Transverse, Thyroid, Whole_Blood