rs9583221 chr13:108154821 T>A
- Sequence
tgacattagtccagtgaccaatat[T/A]gaaaggggacagggagagatgagc
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.86 | 0.14 | 1.16 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, ldl cholesterol change with statins, salmonella-induced pyroptosis, total cholesterol change with statins