rs9587783 chr13:109162287 T>G
- Sequence
agagtcagcaagtgccttagagga[T/G]tcgtttattgccaccaggtgtaag
- ASB in cell types
- Th1-cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Th1-cells | 2.60 | n/a | 2.00 |
Items per page:
1 – 1 of 1