rs9611219 chr22:22201523 T>C
- Sequence
catgccagcctccctgtccaaggg[T/C]ctggtccctgcgagtgcacctgcg
- ASB in cell types
- glioblastoma patient-derived cell model K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | 3.07 | -2.94 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.82 | 0.17 | 5.50 |
Items per page:
1 – 2 of 2