rs9635398 chr15:85802824 G>A
- Sequence
tctatggggcagcaggcatgtgca[G/A]aaacaccagggggagctttaggtg
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) HeLa S3 (cervical adenocarcinoma) GM19239 (male B-cells lymphoblastoid cell line) SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.18 | 0.21 | 1.40 | -0.30 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
