rs970689 chr4:95539386 A>G
- Sequence
ataagccactgcactaatgagaca[A/G]aaacatctctttggaaactgggga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.00 | 0.78 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, coronary artery disease (cad), diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, diastolic blood pressure (dbp), ldl cholesterol, maternal transmission distortion, systolic blood pressure (sbp), total cholesterol, transmission distortion