rs975603 chr7:16891617 G>C
- Sequence
aggaaagagacatgtttagattgt[G/C]gtgcaaagttcctggataagaact
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RH4 (alveolar rhabdomyosarcoma) | -1.17 | 1.78 | 1.11 | |||
| transverse colon | 1.94 | -1.62 | 1.00 |
Items per page:
1 – 2 of 2